Inventory

package
Version: v0.0.0-...-040724e Latest Latest
Warning

This package is not in the latest version of its module.

Go to latest
Published: Jun 6, 2019 License: BSD-3-Clause, GPL-2.0, BSD-3-Clause, GPL-2.0 Imports: 7 Imported by: 0

Documentation

Overview

Package Inventory containing example part structures and defines a PartSource interface which allows the making of a custom inventory.

Index

Constants

This section is empty.

Variables

View Source
var (
	// Vector is an example of a DNA Vector, or plasmid.
	Vector = wtype.DNASequence{
		Nm:      "pUC57",
		Seq:     strings.ToUpper("tcgcgcgtttcggtgatgacggtgaaaacctctgacacatgcagctcccggagacggtcacagcttgtctgtaagcggatgccgggagcagacaagcccgtcagggcgcgtcagcgggtgttggcgggtgtcggggctggcttaactatgcggcatcagagcagattgtactgagagtgcaccatatgcggtgtgaaataccgcacagatgcgtaaggagaaaataccgcatcaggcgccattcgccattcaggctgcgcaactgttgggaagggcgatcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcgattaagttgggtaacgccagggttttcccagtcacgacgttgtaaaacgacggccagtgaattcgagctcggtacctcgcgaatgcatctagatatcggatcccgggcccgtcgactgcagaggcctgcatgcaagcttggcgtaatcatggtcatagctgtttcctgtgtgaaattgttatccgctcacaattccacacaacatacgagccggaagcataaagtgtaaagcctggggtgcctaatgagtgagctaactcacattaattgcgttgcgctcactgcccgctttccagtcgggaaacctgtcgtgccagctgcattaatgaatcggccaacgcgcggggagaggcggtttgcgtattgggcgctcttccgcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaagaacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctgacagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagttgcctgactccccgtcgtgtagataactacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgccgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgttgttgccattgctacaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaacgatcaaggcgagttacatgatcccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtcagaagtaagttggccgcagtgttatcactcatggttatggcagcactgcataattctcttactgtcatgccatccgtaagatgcttttctgtgactggtgagtactcaaccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggataataccgcgccacatagcagaactttaaaagtgctcatcattggaaaacgttcttcggggcgaaaactctcaaggatcttaccgctgttgagatccagttcgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttcaccagcgtttctgggtgagcaaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaatactcatactcttcctttttcaatattattgaagcatttatcagggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggggttccgcgcacatttccccgaaaagtgccacctgacgtctaagaaaccattattatcatgacattaacctataaaaa"),
		Plasmid: true,
	}
	// Promoter is an example of a constitutive E.coli promoter
	Promoter = wtype.DNASequence{
		Nm:  "AndersonProm",
		Seq: strings.ToUpper("ttgacggctagctcagtcctaggtacagtgctagc"),
	}
	// Rbs is an example of a strong Ribosome Binding Site in E.coli
	RBS = wtype.DNASequence{
		Nm:  "BBa_B0034",
		Seq: strings.ToUpper("aaagaggagaaa"),
	}
	// GFP is an example of a common Green Fluorescent Protein
	GFP = wtype.DNASequence{
		Nm:  "GFP_BBa_E0040",
		Seq: strings.ToUpper("atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa"),
	}
	// Terminator is an example of a common Green Fluorescent Protein
	Terminator = wtype.DNASequence{
		Nm:  "Doubleterm_BBa_B0015",
		Seq: strings.ToUpper("ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata"),
	}
)

Example DNA sequences

View Source
var ExampleParts = SequenceMap(map[string]wtype.DNASequence{
	"Vector":   Vector,
	"Promoter": Promoter,
	"Rbs":      RBS,
	"CDS":      GFP,
	"Term":     Terminator,
})

ExampleParts is a map of Sequences which obeys the PartSource interface.

Functions

func MakePartInventory

func MakePartInventory(partSources ...PartSource) ([]wtype.DNASequence, error)

MakePartInventory takes in a variable number of arguments which obey the source interface by having a GetSequences method.

Types

type FileSet

type FileSet []wtype.File

FileSet is a set of files which obeys the PartSource interface. Any fasta or Genbank files will return DNASequences.

func (FileSet) GetSequences

func (fs FileSet) GetSequences() (partslist []wtype.DNASequence, err error)

GetSequences returns all sequences and any errors which occur. Any fasta or Genbank files will return DNASequences.

type PartSource

type PartSource interface {
	GetSequences() ([]wtype.DNASequence, error)
}

PartSource is any type which has a GetSequences method

type SequenceMap

type SequenceMap map[string]wtype.DNASequence

SequenceMap is a map of DNA Sequences which obeys the PartSource interface.

func (SequenceMap) GetSequences

func (ex SequenceMap) GetSequences() (partslist []wtype.DNASequence, err error)

GetSequences returns all sequences and any errors which occur.

type SequenceSet

type SequenceSet []wtype.DNASequence

SequenceSet is a set of DNA Sequences which obeys the PartSource interface.

func (SequenceSet) GetSequences

func (seqs SequenceSet) GetSequences() (partslist []wtype.DNASequence, err error)

GetSequences returns all sequences and any errors which occur.

Jump to

Keyboard shortcuts

? : This menu
/ : Search site
f or F : Jump to
t or T : Toggle theme light dark auto
y or Y : Canonical URL