sam

package
v0.0.0-...-6b08992 Latest Latest
Warning

This package is not in the latest version of its module.

Go to latest
Published: May 16, 2015 License: BSD-3-Clause Imports: 14 Imported by: 0

Documentation

Overview

Package sam implements SAM file format reading and writing. The SAM format is described in the SAM specification.

http://samtools.github.io/hts-specs/SAMv1.pdf

Index

Examples

Constants

View Source
const (
	FlagDecimal = iota
	FlagHex
	FlagString
)

Flag format constants.

Variables

This section is empty.

Functions

func IsValidRecord

func IsValidRecord(r *Record) bool

IsValidRecord returns whether the record satisfies the conditions that it has the Unmapped flag set if it not placed; that the MateUnmapped flag is set if it paired its mate is unplaced; that the CIGAR length matches the sequence and quality string lengths if they are non-zero; and that the Paired, ProperPair, Unmapped and MateUnmapped flags are consistent.

Types

type ASCII

type ASCII byte

ASCII is a printable ASCII character included in an Aux tag.

type Aux

type Aux []byte

An Aux represents an auxilliary data field from a SAM alignment record.

func NewAux

func NewAux(t Tag, value interface{}) (Aux, error)

NewAux returns a new Aux with the given tag, type and value. Acceptable value types and their corresponding SAM type are:

A - ASCII
c - int8
C - uint8
s - int16
S - uint16
i - int, uint or int32
I - int, uint or uint32
f - float32
Z - Text or string
H - Hex
B - []int8, []int16, []int32, []uint8, []uint16, []uint32 or []float32

The handling of int and uint types is provided as a convenience - values must fit within either int32 or uint32 and are converted to the smallest possible representation.

func ParseAux

func ParseAux(text []byte) (Aux, error)

ParseAux returns an AUX parsed from the given text.

func (Aux) Kind

func (a Aux) Kind() byte

Kind returns a byte corresponding to the kind of the auxilliary tag. Returned values are in {'A', 'i', 'f', 'Z', 'H', 'B'}.

func (Aux) String

func (a Aux) String() string

String returns the string representation of an Aux type.

func (Aux) Tag

func (a Aux) Tag() Tag

Tag returns the Tag representation of the Aux tag ID.

func (Aux) Type

func (a Aux) Type() byte

Type returns a byte corresponding to the type of the auxilliary tag. Returned values are in {'A', 'c', 'C', 's', 'S', 'i', 'I', 'f', 'Z', 'H', 'B'}.

func (Aux) Value

func (a Aux) Value() interface{}

Value returns v containing the value of the auxilliary tag.

type AuxFields

type AuxFields []Aux

AuxFields is a set of auxiliary fields.

func (AuxFields) Get

func (a AuxFields) Get(tag Tag) Aux

Get returns the auxiliary field identified by the given tag, or nil if no field matches.

type Cigar

type Cigar []CigarOp

Cigar is a set of CIGAR operations.

func ParseCigar

func ParseCigar(b []byte) (Cigar, error)

ParseCigar returns a Cigar parsed from the provided byte slice.

func (Cigar) IsValid

func (c Cigar) IsValid(length int) bool

IsValid returns whether the CIGAR string is valid for a record of the given sequence length. Validity is defined by the sum of query consuming operations matching the given length, clipping operations only being present at the ends of alignments, and that CigarBack operations only result in query-consuming positions at or right of the start of the alignment.

func (Cigar) String

func (c Cigar) String() string

String returns the CIGAR string for c.

type CigarOp

type CigarOp uint32

CigarOp is a single CIGAR operation including the operation type and the length of the operation.

func NewCigarOp

func NewCigarOp(t CigarOpType, n int) CigarOp

NewCigarOp returns a CIGAR operation of the specified type with length n.

func (CigarOp) Len

func (co CigarOp) Len() int

Len returns the number of positions affected by the CigarOp CIGAR operation.

func (CigarOp) String

func (co CigarOp) String() string

String returns the string representation of the CigarOp

func (CigarOp) Type

func (co CigarOp) Type() CigarOpType

Type returns the type of the CIGAR operation for the CigarOp.

type CigarOpType

type CigarOpType byte

A CigarOpType represents the type of operation described by a CigarOp.

const (
	CigarMatch       CigarOpType = iota // Alignment match (can be a sequence match or mismatch).
	CigarInsertion                      // Insertion to the reference.
	CigarDeletion                       // Deletion from the reference.
	CigarSkipped                        // Skipped region from the reference.
	CigarSoftClipped                    // Soft clipping (clipped sequences present in SEQ).
	CigarHardClipped                    // Hard clipping (clipped sequences NOT present in SEQ).
	CigarPadded                         // Padding (silent deletion from padded reference).
	CigarEqual                          // Sequence match.
	CigarMismatch                       // Sequence mismatch.
	CigarBack                           // Skip backwards.

)

func (CigarOpType) Consumes

func (ct CigarOpType) Consumes() Consume

Consumes returns the CIGAR operation alignment consumption characteristics for the CigarOpType.

The Consume values for each of the CigarOpTypes is as follows:

                  Query  Reference
CigarMatch          1        1
CigarInsertion      1        0
CigarDeletion       0        1
CigarSkipped        0        1
CigarSoftClipped    1        0
CigarHardClipped    0        0
CigarPadded         0        0
CigarEqual          1        1
CigarMismatch       1        1
CigarBack           0       -1

func (CigarOpType) String

func (ct CigarOpType) String() string

String returns the string representation of a CigarOpType.

type Consume

type Consume struct {
	Query, Reference int
}

Consume describes how CIGAR operations consume alignment bases.

Example
package main

import (
	"fmt"

	"github.com/biogo/hts/sam"
)

func min(a, b int) int {
	if a > b {
		return b
	}
	return a
}

func max(a, b int) int {
	if a < b {
		return b
	}
	return a
}

// Overlap returns the length of the overlap between the alignment
// of the SAM record and the interval specified.
//
// Note that this will count repeated matches to the same reference
// location if CigarBack operations are used.
func Overlap(r *sam.Record, start, end int) int {
	var overlap int
	pos := r.Pos
	for _, co := range r.Cigar {
		t := co.Type()
		con := t.Consumes()
		lr := co.Len() * con.Reference
		if con.Query == con.Reference {
			o := min(pos+lr, end) - max(pos, start)
			if o > 0 {
				overlap += o
			}
		}
		pos += lr
	}

	return overlap
}

func main() {
	// Example alignments from the SAM specification:
	//
	// @HD	VN:1.5	SO:coordinate
	// @SQ	SN:ref	LN:45
	// @CO	--------------------------------------------------------
	// @CO	Coor     12345678901234  5678901234567890123456789012345
	// @CO	ref      AGCATGTTAGATAA**GATAGCTGTGCTAGTAGGCAGTCAGCGCCAT
	// @CO	--------------------------------------------------------
	// @CO	+r001/1        TTAGATAAAGGATA*CTG
	// @CO	+r002         aaaAGATAA*GGATA
	// @CO	+r003       gcctaAGCTAA
	// @CO	+r004                     ATAGCT..............TCAGC
	// @CO	-r003                            ttagctTAGGC
	// @CO	-r001/2                                        CAGCGGCAT
	// @CO	--------------------------------------------------------
	// r001	99	ref	7	30	8M2I4M1D3M	=	37	39	TTAGATAAAGGATACTG	*
	// r002	0	ref	9	30	3S6M1P1I4M	*	0	0	AAAAGATAAGGATA	*
	// r003	0	ref	9	30	5S6M	*	0	0	GCCTAAGCTAA	*	SA:Z:ref,29,-,6H5M,17,0;
	// r004	0	ref	16	30	6M14N5M	*	0	0	ATAGCTTCAGC	*
	// r003	2064	ref	29	17	6H5M	*	0	0	TAGGC	*	SA:Z:ref,9,+,5S6M,30,1;
	// r001	147	ref	37	30	9M	=	7	-39	CAGCGGCAT	*	NM:i:1

	const (
		refStart = 0
		refEnd   = 45
	)

	records := []*sam.Record{
		{Name: "r001/1", Pos: 6, Cigar: []sam.CigarOp{
			sam.NewCigarOp(sam.CigarMatch, 8),
			sam.NewCigarOp(sam.CigarInsertion, 2),
			sam.NewCigarOp(sam.CigarMatch, 4),
			sam.NewCigarOp(sam.CigarDeletion, 1),
			sam.NewCigarOp(sam.CigarMatch, 3),
		}},
		{Name: "r002", Pos: 8, Cigar: []sam.CigarOp{
			sam.NewCigarOp(sam.CigarSoftClipped, 3),
			sam.NewCigarOp(sam.CigarMatch, 6),
			sam.NewCigarOp(sam.CigarPadded, 1),
			sam.NewCigarOp(sam.CigarInsertion, 1),
			sam.NewCigarOp(sam.CigarMatch, 4),
		}},
		{Name: "r003", Pos: 8, Cigar: []sam.CigarOp{
			sam.NewCigarOp(sam.CigarSoftClipped, 5),
			sam.NewCigarOp(sam.CigarMatch, 6),
		}},
		{Name: "r004", Pos: 15, Cigar: []sam.CigarOp{
			sam.NewCigarOp(sam.CigarMatch, 6),
			sam.NewCigarOp(sam.CigarSkipped, 14),
			sam.NewCigarOp(sam.CigarMatch, 5),
		}},
		{Name: "r003", Pos: 28, Cigar: []sam.CigarOp{
			sam.NewCigarOp(sam.CigarHardClipped, 6),
			sam.NewCigarOp(sam.CigarMatch, 5),
		}},
		{Name: "r001/2", Pos: 36, Cigar: []sam.CigarOp{
			sam.NewCigarOp(sam.CigarMatch, 9),
		}},
	}

	for _, r := range records {
		fmt.Printf("%q overlaps reference by %d letters\n", r.Name, Overlap(r, refStart, refEnd))
	}

}
Output:

"r001/1" overlaps reference by 15 letters
"r002" overlaps reference by 10 letters
"r003" overlaps reference by 6 letters
"r004" overlaps reference by 11 letters
"r003" overlaps reference by 5 letters
"r001/2" overlaps reference by 9 letters

type Doublet

type Doublet byte

Doublet is a nybble-encode pair of nucleotide bases.

type Flags

type Flags uint16

A Flags represents a BAM record's alignment FLAG field.

const (
	Paired        Flags = 1 << iota // The read is paired in sequencing, no matter whether it is mapped in a pair.
	ProperPair                      // The read is mapped in a proper pair.
	Unmapped                        // The read itself is unmapped; conflictive with ProperPair.
	MateUnmapped                    // The mate is unmapped.
	Reverse                         // The read is mapped to the reverse strand.
	MateReverse                     // The mate is mapped to the reverse strand.
	Read1                           // This is read1.
	Read2                           // This is read2.
	Secondary                       // Not primary alignment.
	QCFail                          // QC failure.
	Duplicate                       // Optical or PCR duplicate.
	Supplementary                   // Supplementary alignment, indicates alignment is part of a chimeric alignment.
)

func (Flags) String

func (f Flags) String() string

String representation of BAM alignment flags:

0x001 - p - Paired
0x002 - P - ProperPair
0x004 - u - Unmapped
0x008 - U - MateUnmapped
0x010 - r - Reverse
0x020 - R - MateReverse
0x040 - 1 - Read1
0x080 - 2 - Read2
0x100 - s - Secondary
0x200 - f - QCFail
0x400 - d - Duplicate
0x800 - S - Supplementary

Note that flag bits are represented high order to the right.

type GroupOrder

type GroupOrder int

GroupOrder indicates the grouping order of a SAM or BAM file.

const (
	GroupUnspecified GroupOrder = iota
	GroupNone
	GroupQuery
	GroupReference
)

func (GroupOrder) String

func (g GroupOrder) String() string

String returns the string representation of a GroupOrder.

type Header struct {
	Version    string
	SortOrder  SortOrder
	GroupOrder GroupOrder
	Comments   []string
	// contains filtered or unexported fields
}

Header is a SAM or BAM header.

func NewHeader

func NewHeader(text []byte, r []*Reference) (*Header, error)

NewHeader returns a new Header based on the given text and list of References. If there is a conflict between the text and the given References NewHeader will return a non-nil error.

func (*Header) AddProgram

func (bh *Header) AddProgram(p *Program) error

AddProgram adds p to the Header.

func (*Header) AddReadGroup

func (bh *Header) AddReadGroup(rg *ReadGroup) error

AddReadGroup adds rg to the Header.

func (*Header) AddReference

func (bh *Header) AddReference(r *Reference) error

AddReference adds r to the Header.

func (*Header) Clone

func (bh *Header) Clone() *Header

Clone returns a deep copy of the receiver.

func (*Header) DecodeBinary

func (bh *Header) DecodeBinary(r io.Reader) error

DecodeBinary unmarshals a Header from the given io.Reader. The byte stream must be in the format described in the SAM specification, section 4.2.

func (*Header) EncodeBinary

func (bh *Header) EncodeBinary(w io.Writer) error

EncodeBinary writes a binary encoding of the Header to the given io.Writer. The format of the encoding is defined in the SAM specification, section 4.2.

func (*Header) MarshalBinary

func (bh *Header) MarshalBinary() ([]byte, error)

MarshalBinary implements the encoding.BinaryMarshaler.

func (*Header) MarshalText

func (bh *Header) MarshalText() ([]byte, error)

MarshalText implements the encoding.TextMarshaler interface.

func (*Header) Progs

func (bh *Header) Progs() []*Program

Progs returns the Header's list of Programs. The returned slice should not be altered.

func (*Header) RGs

func (bh *Header) RGs() []*ReadGroup

RGs returns the Header's list of ReadGroups. The returned slice should not be altered.

func (*Header) Refs

func (bh *Header) Refs() []*Reference

Refs returns the Header's list of References. The returned slice should not be altered.

func (*Header) UnmarshalBinary

func (bh *Header) UnmarshalBinary(b []byte) error

UnmarshalBinary implements the encoding.BinaryUnmarshaler interface.

func (*Header) UnmarshalText

func (bh *Header) UnmarshalText(text []byte) error

UnmarshalText implements the encoding.TextUnmarshaler interface.

func (*Header) Validate

func (bh *Header) Validate(r *Record) error

Validate checks r against the Header for record validity according to the SAM specification:

  • a program auxiliary field must refer to a program listed in the header
  • a read group auxiliary field must refer to a read group listed in the header and these must agree on platform unit and library.

type Hex

type Hex []byte

Hex is a byte slice represented as a hex string in an Aux tag.

type Iterator

type Iterator struct {
	// contains filtered or unexported fields
}

Iterator wraps a Reader to provide a convenient loop interface for reading SAM/BAM data. Successive calls to the Next method will step through the features of the provided Reader. Iteration stops unrecoverably at EOF or the first error.

func NewIterator

func NewIterator(r RecordReader) *Iterator

NewIterator returns a Iterator to read from r.

i, err := NewIterator(r)
if err != nil {
	return err
}
for i.Next() {
	fn(i.Record())
}
return i.Error()

func (*Iterator) Error

func (i *Iterator) Error() error

Error returns the first non-EOF error that was encountered by the Iterator.

func (*Iterator) Next

func (i *Iterator) Next() bool

Next advances the Iterator past the next record, which will then be available through the Record method. It returns false when the iteration stops, either by reaching the end of the input or an error. After Next returns false, the Error method will return any error that occurred during iteration, except that if it was io.EOF, Error will return nil.

func (*Iterator) Record

func (i *Iterator) Record() *Record

Record returns the most recent record read by a call to Next.

type Program

type Program struct {
	// contains filtered or unexported fields
}

Program represents a SAM program.

func NewProgram

func NewProgram(uid, name, command, prev, v string) *Program

NewProgram returns a Program with the given unique ID, name, command, previous program ID in the pipeline and version.

func (*Program) Clone

func (p *Program) Clone() *Program

Clone returns a deep copy of the Program.

func (*Program) ID

func (p *Program) ID() int

ID returns the header ID for the Program.

func (*Program) Name

func (p *Program) Name() string

Name returns the program's name.

func (*Program) Previous

func (p *Program) Previous() string

Previous returns the unique ID for the previous program in the pipeline.

func (*Program) String

func (p *Program) String() string

String returns a string representation of the program according to the SAM specification section 1.3,

func (*Program) UID

func (p *Program) UID() string

UID returns the unique program ID for the program.

func (*Program) Version

func (p *Program) Version() string

Version returns the version of the program.

type ReadGroup

type ReadGroup struct {
	// contains filtered or unexported fields
}

ReadGroup represents a sequencing read group.

func NewReadGroup

func NewReadGroup(name, center, desc, lib, prog, plat, unit, sample, flow, key string, date time.Time, size int) (*ReadGroup, error)

NewReadGroup returns a ReadGroup with the given name, center, description, library, program, platform, unique platform unit, sample name, flow order, key, date of read group production, and predicted median insert size sequence.

func (*ReadGroup) Clone

func (r *ReadGroup) Clone() *ReadGroup

Clone returns a deep copy of the ReadGroup.

func (*ReadGroup) ID

func (r *ReadGroup) ID() int

ID returns the header ID for the ReadGroup.

func (*ReadGroup) Library

func (r *ReadGroup) Library() string

Library returns the library name for the read group.

func (*ReadGroup) Name

func (r *ReadGroup) Name() string

Name returns the read group's name.

func (*ReadGroup) PlatformUnit

func (r *ReadGroup) PlatformUnit() string

PlatformUnit returns the unique platform unit for the read group.

func (*ReadGroup) String

func (r *ReadGroup) String() string

String returns a string representation of the read group according to the SAM specification section 1.3,

func (*ReadGroup) Time

func (r *ReadGroup) Time() time.Time

Time returns the time the read group was produced.

type Reader

type Reader struct {
	// contains filtered or unexported fields
}

Reader implements SAM format reading.

func NewReader

func NewReader(r io.Reader) (*Reader, error)

NewReader returns a new Reader, reading from the given io.Reader.

func (*Reader) Header

func (r *Reader) Header() *Header

Header returns the SAM Header held by the Reader.

func (*Reader) Read

func (r *Reader) Read() (*Record, error)

Read returns the next sam.Record in the SAM stream.

type Record

type Record struct {
	Name      string
	Ref       *Reference
	Pos       int
	MapQ      byte
	Cigar     Cigar
	Flags     Flags
	MateRef   *Reference
	MatePos   int
	TempLen   int
	Seq       Seq
	Qual      []byte
	AuxFields AuxFields
}

Record represents a SAM/BAM record.

func NewRecord

func NewRecord(name string, ref, mRef *Reference, p, mPos, tLen int, mapQ byte, co []CigarOp, seq, qual []byte, aux []Aux) (*Record, error)

NewRecord returns a Record, checking for consistency of the provided attributes.

func (*Record) Bin

func (r *Record) Bin() int

Bin returns the BAM index bin of the record.

func (*Record) End

func (r *Record) End() int

End returns the highest query-consuming coordinate end of the alignment. The position returned by End is not valid if r.Cigar.IsValid(r.Seq.Length) is false.

func (*Record) Len

func (r *Record) Len() int

Len returns the length of the alignment.

func (*Record) MarshalSAM

func (r *Record) MarshalSAM(flags int) ([]byte, error)

MarshalSAM formats a Record as SAM using the specified flag format. Acceptable formats are FlagDecimal, FlagHex and FlagString.

func (*Record) MarshalText

func (r *Record) MarshalText() ([]byte, error)

MarshalText implements encoding.TextMarshaler. It calls MarshalSAM with FlagDecimal.

func (*Record) RefID

func (r *Record) RefID() int

RefID returns the reference ID for the Record.

func (*Record) Start

func (r *Record) Start() int

Start returns the lower-coordinate end of the alignment.

func (*Record) Strand

func (r *Record) Strand() int8

Strand returns an int8 indicating the strand of the alignment. A positive return indicates alignment in the forward orientation, a negative returns indicates alignment in the reverse orientation.

func (*Record) String

func (r *Record) String() string

String returns a string representation of the Record.

func (*Record) Tag

func (r *Record) Tag(tag []byte) (v Aux, ok bool)

Tag returns an Aux tag whose tag ID matches the first two bytes of tag and true. If no tag matches, nil and false are returned.

func (*Record) UnmarshalSAM

func (r *Record) UnmarshalSAM(h *Header, b []byte) error

UnmarshalSAM parses a SAM format alignment line in the provided []byte, using references from the provided Header. If a nil Header is passed to UnmarshalSAM and the SAM data include non-empty refence and mate reference names, fake references with zero length and an ID of -1 are created to hold the reference names.

func (*Record) UnmarshalText

func (r *Record) UnmarshalText(b []byte) error

UnmarshalText implements the encoding.TextUnmarshaler. It calls UnmarshalSAM with a nil Header.

type RecordReader

type RecordReader interface {
	Read() (*Record, error)
}

RecordReader wraps types that can read SAM Records.

type Reference

type Reference struct {
	// contains filtered or unexported fields
}

Reference is a mapping reference.

func NewReference

func NewReference(name, assemID, species string, length int, md5 []byte, uri *url.URL) (*Reference, error)

NewReference returns a new Reference based on the given parameters. Only name and length are mandatory and length must be a valid reference length according to the SAM specification, [1, 1<<31).

func (*Reference) AssemblyID

func (r *Reference) AssemblyID() string

AssemblyID returns the assembly ID of the reference.

func (*Reference) Clone

func (r *Reference) Clone() *Reference

Clone returns a deep copy of the Reference.

func (*Reference) ID

func (r *Reference) ID() int

ID returns the header ID of the Reference.

func (*Reference) Len

func (r *Reference) Len() int

Len returns the length of the reference sequence.

func (*Reference) MD5

func (r *Reference) MD5() []byte

MD5 returns a 16 byte slice holding the MD5 sum of the reference sequence.

func (*Reference) Name

func (r *Reference) Name() string

Name returns the reference name.

func (*Reference) SetLen

func (r *Reference) SetLen(l int) error

SetLen sets the length of the reference sequence to l. The given length must be a valid SAM reference length.

func (*Reference) Species

func (r *Reference) Species() string

Species returns the reference species.

func (*Reference) String

func (r *Reference) String() string

String returns a string representation of the Reference according to the SAM specification section 1.3,

func (*Reference) URI

func (r *Reference) URI() string

URI returns the URI of the reference.

type Seq

type Seq struct {
	Length int
	Seq    []Doublet
}

Seq is a nybble-encode pair of nucleotide sequence.

func NewSeq

func NewSeq(s []byte) Seq

NewSeq returns a new Seq based on the given byte slice.

func (Seq) Expand

func (ns Seq) Expand() []byte

Expand returns the byte encoded form of the receiver.

type SortOrder

type SortOrder int

SortOrder indicates the sort order of a SAM or BAM file.

const (
	UnknownOrder SortOrder = iota
	Unsorted
	QueryName
	Coordinate
)

func (SortOrder) String

func (so SortOrder) String() string

String returns the string representation of a SortOrder.

type Tag

type Tag [2]byte

A Tag represents an auxilliary tag label.

func NewTag

func NewTag(tag string) Tag

NewTag returns a Tag from the tag string. It panics is len(tag) != 2.

func (Tag) String

func (t Tag) String() string

String returns a string representation of a Tag.

type Text

type Text []byte

Text is a byte slice represented as a string in an Aux tag.

type Writer

type Writer struct {
	// contains filtered or unexported fields
}

Writer implements SAM format writing.

func NewWriter

func NewWriter(w io.Writer, h *Header, flags int) (*Writer, error)

NewWriter returns a Writer to the given io.Writer using h for the SAM header. The format of flags for SAM lines can be FlagDecimal, FlagHex or FlagString.

func (*Writer) Write

func (w *Writer) Write(r *Record) error

Write writes r to the SAM stream.

Jump to

Keyboard shortcuts

? : This menu
/ : Search site
f or F : Jump to
y or Y : Canonical URL