Documentation
¶
Overview ¶
Package align provide basic sequence alignment types and helpers.
Index ¶
Examples ¶
Constants ¶
This section is empty.
Variables ¶
var ( ErrMismatchedTypes = errors.New("align: mismatched sequence types") ErrMismatchedAlphabets = errors.New("align: mismatched alphabets") ErrNoAlphabet = errors.New("align: no alphabet") ErrNotGappedAlphabet = errors.New("align: alphabet does not have gap at position 0") ErrTypeNotHandled = errors.New("align: sequence type not handled") ErrMatrixNotSquare = errors.New("align: scoring matrix is not square") )
Functions ¶
Types ¶
type Aligner ¶
type Aligner interface {
Align(reference, query AlphabetSlicer) ([]feat.Pair, error)
}
An Aligner aligns the sequence data of two type-matching Slicers, returning an ordered slice of features describing matching and mismatching segments. The sequences to be aligned must have a valid gap letter in the first position of their alphabet; the alphabets {DNA,RNA}{gapped,redundant} and Protein provided by the alphabet package satisfy this.
type AlphabetSlicer ¶
type ErrMatrixWrongSize ¶
func (ErrMatrixWrongSize) Error ¶
func (e ErrMatrixWrongSize) Error() string
type Fitted ¶
type Fitted Linear
Fitted is the linear gap penalty fitted Needleman-Wunsch aligner type.
func (Fitted) Align ¶
func (a Fitted) Align(reference, query AlphabetSlicer) ([]feat.Pair, error)
Align aligns two sequences using a modified Needleman-Wunsch algorithm that finds a local region of the reference with high similarity to the query. It returns an alignment description or an error if the scoring matrix is not square, or the sequence data types or alphabets do not match.
Example ¶
fsa := &linear.Seq{Seq: alphabet.BytesToLetters([]byte("GTTGACAGACTAGATTCACG"))}
fsa.Alpha = alphabet.DNAgapped
fsb := &linear.Seq{Seq: alphabet.BytesToLetters([]byte("GACAGACGA"))}
fsb.Alpha = alphabet.DNAgapped
// Query letter
// - A C G T
// - 0 -5 -5 -5 -5
// A -5 10 -3 -1 -4
// C -5 -3 9 -5 0
// G -5 -1 -5 7 -3
// T -5 -4 0 -3 8
fitted := Fitted{
{0, -5, -5, -5, -5},
{-5, 10, -3, -1, -4},
{-5, -3, 9, -5, 0},
{-5, -1, -5, 7, -3},
{-5, -4, 0, -3, 8},
}
aln, err := fitted.Align(fsa, fsb)
if err == nil {
fmt.Printf("%s\n", aln)
fa := Format(fsa, fsb, aln, '-')
fmt.Printf("%s\n%s\n", fa[0], fa[1])
}
Output: [[3,10)/[0,7)=62 [10,12)/-=-10 [12,14)/[7,9)=17] GACAGACTAGA GACAGAC--GA
type FittedAffine ¶
type FittedAffine Affine
FittedAffine is the affine gap penalty fitted Needleman-Wunsch aligner type.
func (FittedAffine) Align ¶
func (a FittedAffine) Align(reference, query AlphabetSlicer) ([]feat.Pair, error)
Align aligns two sequences using a modified Needleman-Wunsch algorithm that finds a local region of the reference with high similarity to the query. It returns an alignment description or an error if the scoring matrix is not square, or the sequence data types or alphabets do not match.
Example ¶
fsa := &linear.Seq{Seq: alphabet.BytesToLetters([]byte("ATTGGCAATGA"))}
fsa.Alpha = alphabet.DNAgapped
fsb := &linear.Seq{Seq: alphabet.BytesToLetters([]byte("ATAGGAA"))}
fsb.Alpha = alphabet.DNAgapped
// Query letter
// - A C G T
// - 0 -1 -1 -1 -1
// A -1 1 -1 -1 -1
// C -1 -1 1 -1 -1
// G -1 -1 -1 1 -1
// T -1 -1 -1 -1 1
//
// Gap open: -5
fitted := FittedAffine{
Matrix: Linear{
{0, -1, -1, -1, -1},
{-1, 1, -1, -1, -1},
{-1, -1, 1, -1, -1},
{-1, -1, -1, 1, -1},
{-1, -1, -1, -1, 1},
},
GapOpen: -5,
}
aln, err := fitted.Align(fsa, fsb)
if err == nil {
fmt.Printf("%s\n", aln)
fa := Format(fsa, fsb, aln, '-')
fmt.Printf("%s\n%s\n", fa[0], fa[1])
}
Output: [[0,7)/[0,7)=3] ATTGGCA ATAGGAA
type Linear ¶
type Linear [][]int
A Linear is a basic linear gap penalty alignment description. It is a square scoring matrix with the first column and first row specifying gap penalties.
type NW ¶
type NW Linear
NW is the linear gap penalty Needleman-Wunsch aligner type.
func (NW) Align ¶
func (a NW) Align(reference, query AlphabetSlicer) ([]feat.Pair, error)
Align aligns two sequences using the Needleman-Wunsch algorithm. It returns an alignment description or an error if the scoring matrix is not square, or the sequence data types or alphabets do not match.
Example ¶
nwsa := &linear.Seq{Seq: alphabet.BytesToLetters([]byte("AGACTAGTTA"))}
nwsa.Alpha = alphabet.DNAgapped
nwsb := &linear.Seq{Seq: alphabet.BytesToLetters([]byte("GACAGACG"))}
nwsb.Alpha = alphabet.DNAgapped
// Query letter
// - A C G T
// - 0 -5 -5 -5 -5
// A -5 10 -3 -1 -4
// C -5 -3 9 -5 0
// G -5 -1 -5 7 -3
// T -5 -4 0 -3 8
needle := NW{
{0, -5, -5, -5, -5},
{-5, 10, -3, -1, -4},
{-5, -3, 9, -5, 0},
{-5, -1, -5, 7, -3},
{-5, -4, 0, -3, 8},
}
aln, err := needle.Align(nwsa, nwsb)
if err == nil {
fmt.Printf("%s\n", aln)
fa := Format(nwsa, nwsb, aln, '-')
fmt.Printf("%s\n%s\n", fa[0], fa[1])
}
Output: [[0,1)/-=-5 [1,4)/[0,3)=26 [4,5)/-=-5 [5,10)/[3,8)=12] AGACTAGTTA -GAC-AGACG
type NWAffine ¶
type NWAffine Affine
NWAffine is the affine gap penalty Needleman-Wunsch aligner type.
func (NWAffine) Align ¶
func (a NWAffine) Align(reference, query AlphabetSlicer) ([]feat.Pair, error)
Align aligns two sequences using the Needleman-Wunsch algorithm. It returns an alignment description or an error if the scoring matrix is not square, or the sequence data types or alphabets do not match.
Example ¶
nwsa := &linear.Seq{Seq: alphabet.BytesToLetters([]byte("ATAGGAAG"))}
nwsa.Alpha = alphabet.DNAgapped
nwsb := &linear.Seq{Seq: alphabet.BytesToLetters([]byte("ATTGGCAATG"))}
nwsb.Alpha = alphabet.DNAgapped
// Query letter
// - A C G T
// - 0 -1 -1 -1 -1
// A -1 1 -1 -1 -1
// C -1 -1 1 -1 -1
// G -1 -1 -1 1 -1
// T -1 -1 -1 -1 1
//
// Gap open: -5
needle := NWAffine{
Matrix: Linear{
{0, -1, -1, -1, -1},
{-1, 1, -1, -1, -1},
{-1, -1, 1, -1, -1},
{-1, -1, -1, 1, -1},
{-1, -1, -1, -1, 1},
},
GapOpen: -5,
}
aln, err := needle.Align(nwsa, nwsb)
if err == nil {
fmt.Printf("%s\n", aln)
fa := Format(nwsa, nwsb, aln, '-')
fmt.Printf("%s\n%s\n", fa[0], fa[1])
}
Output: [[0,7)/[0,7)=3 -/[7,9)=-7 [7,8)/[9,10)=1] ATAGGAA--G ATTGGCAATG
type SW ¶
type SW Linear
SW is the Smith-Waterman aligner type. Matrix is a square scoring matrix with the last column and last row specifying gap penalties. Currently gap opening is not considered.
type SWAffine ¶
type SWAffine Affine
SWAffine is the affine gap penalty Smith-Waterman aligner type.
func (SWAffine) Align ¶
func (a SWAffine) Align(reference, query AlphabetSlicer) ([]feat.Pair, error)
Align aligns two sequences using the Smith-Waterman algorithm. It returns an alignment description or an error if the scoring matrix is not square, or the sequence data types or alphabets do not match.
Example ¶
swsa := &linear.Seq{Seq: alphabet.BytesToLetters([]byte("ATAGGAAG"))}
swsa.Alpha = alphabet.DNAgapped
swsb := &linear.Seq{Seq: alphabet.BytesToLetters([]byte("ATTGGCAATG"))}
swsb.Alpha = alphabet.DNAgapped
// Query letter
// - A C G T
// - 0 -1 -1 -1 -1
// A -1 1 -1 -1 -1
// C -1 -1 1 -1 -1
// G -1 -1 -1 1 -1
// T -1 -1 -1 -1 1
//
// Gap open: -5
smith := SWAffine{
Matrix: Linear{
{0, -1, -1, -1, -1},
{-1, 1, -1, -1, -1},
{-1, -1, 1, -1, -1},
{-1, -1, -1, 1, -1},
{-1, -1, -1, -1, 1},
},
GapOpen: -5,
}
aln, err := smith.Align(swsa, swsb)
if err == nil {
fmt.Printf("%s\n", aln)
fa := Format(swsa, swsb, aln, '-')
fmt.Printf("%s\n%s\n", fa[0], fa[1])
}
Output: [[0,7)/[0,7)=3] ATAGGAA ATTGGCA
Source Files
¶
Directories
¶
| Path | Synopsis |
|---|---|
|
Package matrix provides a variety of alignment scoring matrices for sequence alignment.
|
Package matrix provides a variety of alignment scoring matrices for sequence alignment. |
|
Package pals implements functions and methods required for PALS sequence alignment.
|
Package pals implements functions and methods required for PALS sequence alignment. |
|
dp
Package providing PALS dynamic programming alignment routines.
|
Package providing PALS dynamic programming alignment routines. |
|
filter
Package providing PALS sequence hit filter routines based on 'Efficient q-gram filters for finding all 𝛜-matches over a given length.'
|
Package providing PALS sequence hit filter routines based on 'Efficient q-gram filters for finding all 𝛜-matches over a given length.' |