variScan
variScan is a bioinformatics tool developed in the Shi Lab at the Monash Biomedicine Discovery Institute for efficient mapping of sequencing reads to a reference sequence library.
Unlike conventional read aligners, variScan is specifically designed to map read pairs to the most similar reference among thousands of highly similar, short reference sequences (typically hundreds of bases in length).
Download and installation
Binary releases of variScan are available from the GitHub repository: https://github.com/ShiLab-Bioinformatics/variScan. The program can be installed by simply decompressing the downloaded package.
variScan currently supports x86-64 Linux systems and requires /bin/bash. If bash is located elsewhere on your system, update the first line in run_variScan.sh to point to the correct path.
Running variScan
The only entry for running variScan is run_variScan.sh.
Usage: ./run_variScan.sh <IN:file1.fastq.gz> <IN:file2.fastq.gz> <IN:library.csv> <OUT:output.xlsx>
The input files file1.fastq.gz and file2.fastq.gz must correspond to the first and second reads of each paired-end read, respectively. Reads must be generated using a stranded protocol (forward–reverse orientation).
Referece sequences are provided in input file library.csv. This file must contain exactly two columns: the reference sequence (first column) and the sequence name (second column). Do not include a header row or column titles. All values should be plain text without quotation marks.
The output spreadsheet is written in output.xlsx.
Below is an example of library.csv.
ATCGGTCAATCGTAGCTAATCGGTCAATCGTAGCTAATCGGTCAATCGTAGCTA,seq001
TACGGTCAATCGTAGCTAATCGGTCAATCGTAGCTAATCGGTCAATCGTAGCTT,seq002
CCCGGTCAATCGTAGCTAATCGGTCAATCGTAGCTAATCGGTCAATCGTAGCTG,seq003
......
Read alignment rules
Each read in a pair is aligned to all reference sequences without allowing insertions or deletions (indels). Alignments are evaluated at all possible positions, including partial overlaps. For each read–reference pair, the optimal alignment position is defined as the one with the highest number of matched bases.
A read pair is considered mappable if, at its respective optimal alignment position, at least one read end has three or fewer mismatches.
For each read pair, the reference sequence with the highest combined number of matched bases across both ends (at their respective optimal positions) is selected as the final alignment target. If multiple equally optimal targets are identified, the read pair is reported as unmappable.