poly

Documentation

Overview

Package poly provides the core Sequence struct and methods for working with DNA, RNA, and Amino Acid sequences in Poly.

Each Sequence struct can be broken down into the following:

Meta: Author, Date, Description, Name, Version, etc. Features: A list of Feature structs containing feature locations and other information. Sequece: The actual sequence string.

As well as other info like source file checksums, etc.

This package will likely be overhauled before 1.0 release to be more flexible and robust. So be on the lookup for breaking changes in future releases.

Index

• type Feature
  • func (feature Feature) GetSequence() string
• type Location
• type Locus
• type Meta
• type Reference
• type Sequence
  • func (sequence *Sequence) AddFeature(feature *Feature) []Feature

Examples

• Feature.GetSequence
• Sequence.AddFeature

Types

type Feature

type Feature struct {
	Name string //Seqid in gff, name in gbk
	//gff specific
	Source               string            `json:"source"`
	Type                 string            `json:"type"`
	Score                string            `json:"score"`
	Strand               string            `json:"strand"`
	Phase                string            `json:"phase"`
	Attributes           map[string]string `json:"attributes"`
	GbkLocationString    string            `json:"gbk_location_string"`
	Sequence             string            `json:"sequence"`
	SequenceLocation     Location          `json:"sequence_location"`
	SequenceHash         string            `json:"sequence_hash"`
	Description          string            `json:"description"`
	SequenceHashFunction string            `json:"hash_function"`
	ParentSequence       *Sequence         `json:"-"`
}

Feature holds a single annotation in a struct. from https://github.com/blachlylab/gff3/blob/master/gff3.go

func (Feature) GetSequence

func (feature Feature) GetSequence() string

GetSequence is a method wrapper to get a Feature's sequence. Mutates with Sequence.

Example

// Sequence for greenflourescent protein (GFP) that we're using as test data for this example.
gfpSequence := "ATGGCTAGCAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGGCACAAATTTTCTGTCAGTGGAGAGGGTGAAGGTGATGCTACATACGGAAAGCTTACCCTTAAATTTATTTGCACTACTGGAAAACTACCTGTTCCATGGCCAACACTTGTCACTACTTTCTCTTATGGTGTTCAATGCTTTTCCCGTTATCCGGATCATATGAAACGGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAACGCACTATATCTTTCAAAGATGACGGGAACTACAAGACGCGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTAATCGTATCGAGTTAAAAGGTATTGATTTTAAAGAAGATGGAAACATTCTCGGACACAAACTCGAGTACAACTATAACTCACACAATGTATACATCACGGCAGACAAACAAAAGAATGGAATCAAAGCTAACTTCAAAATTCGCCACAACATTGAAGATGGATCCGTTCAACTAGCAGACCATTATCAACAAAATACTCCAATTGGCGATGGCCCTGTCCTTTTACCAGACAACCATTACCTGTCGACACAATCTGCCCTTTCGAAAGATCCCAACGAAAAGCGTGACCACATGGTCCTTCTTGAGTTTGTAACTGCTGCTGGGATTACACATGGCATGGATGAGCTCTACAAATAA"

// initialize sequence and feature structs.
var sequence Sequence
var feature Feature

// set the initialized sequence struct's sequence.
sequence.Sequence = gfpSequence

// Set the initialized feature name and sequence location.
feature.Name = "Green Flourescent Protein"
feature.SequenceLocation.Start = 0
feature.SequenceLocation.End = len(sequence.Sequence)

// Add the GFP feature to the sequence struct.
sequence.AddFeature(&feature)

// get the GFP feature sequence string from the sequence struct.
featureSequence := feature.GetSequence()

// check to see if the feature was inserted properly into the sequence.
fmt.Println(gfpSequence == featureSequence)

Output:

true

type Location

type Location struct {
	Start             int        `json:"start"`
	End               int        `json:"end"`
	Complement        bool       `json:"complement"`
	Join              bool       `json:"join"`
	FivePrimePartial  bool       `json:"five_prime_partial"`
	ThreePrimePartial bool       `json:"three_prime_partial"`
	SubLocations      []Location `json:"sub_locations"`
}

Location holds nested location info for sequence region.

type Locus

type Locus struct {
	Name             string `json:"name"`
	SequenceLength   string `json:"sequence_length"`
	MoleculeType     string `json:"molecule_type"`
	GenbankDivision  string `json:"genbank_division"`
	ModificationDate string `json:"modification_date"`
	SequenceCoding   string `json:"sequence_coding"`
	Circular         bool   `json:"circular"`
	Linear           bool   `json:"linear"`
}

Locus holds Locus information in a Meta struct.

type Meta

type Meta struct {
	Name        string            `json:"name"`
	GffVersion  string            `json:"gff_version"`
	RegionStart int               `json:"region_start"`
	RegionEnd   int               `json:"region_end"`
	Size        int               `json:"size"`
	Type        string            `json:"type"`
	Date        string            `json:"date"`
	Definition  string            `json:"definition"`
	Accession   string            `json:"accession"`
	Version     string            `json:"version"`
	Keywords    string            `json:"keywords"`
	Organism    string            `json:"organism"`
	Source      string            `json:"source"`
	Origin      string            `json:"origin"`
	Locus       Locus             `json:"locus"`
	References  []Reference       `json:"references"`
	Other       map[string]string `json:"other"`
}

Meta Holds all the meta information of an Sequence struct.

type Reference

type Reference struct {
	Index   string `json:"index"`
	Authors string `json:"authors"`
	Title   string `json:"title"`
	Journal string `json:"journal"`
	PubMed  string `json:"pub_med"`
	Remark  string `json:"remark"`
	Range   string `json:"range"`
}

Reference holds information one reference in a Meta struct.

type Sequence

type Sequence struct {
	Meta                 Meta      `json:"meta"`
	Description          string    `json:"description"`
	SequenceHash         string    `json:"sequence_hash"`
	SequenceHashFunction string    `json:"hash_function"`
	Sequence             string    `json:"sequence"`
	Features             []Feature `json:"features"`
	CheckSum             [32]byte  `json:"checkSum"` // blake3 checksum of the parsed file itself. Useful for if you want to check if incoming genbank/gff files are different.
}

Sequence holds all sequence information in a single struct.

func (*Sequence) AddFeature

func (sequence *Sequence) AddFeature(feature *Feature) []Feature

AddFeature is the canonical way to add a Feature into a Sequence struct. Appending a Feature struct directly to Sequence.Feature's will break .GetSequence() method.

Example

// Sequence for greenflourescent protein (GFP) that we're using as test data for this example.
gfpSequence := "ATGGCTAGCAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGGCACAAATTTTCTGTCAGTGGAGAGGGTGAAGGTGATGCTACATACGGAAAGCTTACCCTTAAATTTATTTGCACTACTGGAAAACTACCTGTTCCATGGCCAACACTTGTCACTACTTTCTCTTATGGTGTTCAATGCTTTTCCCGTTATCCGGATCATATGAAACGGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAACGCACTATATCTTTCAAAGATGACGGGAACTACAAGACGCGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTAATCGTATCGAGTTAAAAGGTATTGATTTTAAAGAAGATGGAAACATTCTCGGACACAAACTCGAGTACAACTATAACTCACACAATGTATACATCACGGCAGACAAACAAAAGAATGGAATCAAAGCTAACTTCAAAATTCGCCACAACATTGAAGATGGATCCGTTCAACTAGCAGACCATTATCAACAAAATACTCCAATTGGCGATGGCCCTGTCCTTTTACCAGACAACCATTACCTGTCGACACAATCTGCCCTTTCGAAAGATCCCAACGAAAAGCGTGACCACATGGTCCTTCTTGAGTTTGTAACTGCTGCTGGGATTACACATGGCATGGATGAGCTCTACAAATAA"

// initialize sequence and feature structs.
var sequence Sequence
var feature Feature

// set the initialized sequence struct's sequence.
sequence.Sequence = gfpSequence

// Set the initialized feature name and sequence location.
feature.Name = "Green Flourescent Protein"
feature.SequenceLocation.Start = 0
feature.SequenceLocation.End = len(sequence.Sequence)

// Add the GFP feature to the sequence struct.
sequence.AddFeature(&feature)

// get the GFP feature sequence string from the sequence struct.
featureSequence := feature.GetSequence()

// check to see if the feature was inserted properly into the sequence.
fmt.Println(gfpSequence == featureSequence)

Output:

true