Documentation
¶
Overview ¶
Package polyjson provides utilities to read and write poly.Sequence structs as JSON.
Poly's JSON schema is still in flux so be on the lookout for breaking changes as we approach the 1.0 release.
Example ¶
package main
import (
"fmt"
"os"
"path/filepath"
"time"
"github.com/TimothyStiles/poly/io/polyjson"
"github.com/TimothyStiles/poly/seqhash"
)
func main() {
// this example also is run by the poly's test suite so this just sets up a temporary directory for writing files
tmpDataDir, err := os.MkdirTemp("", "data-*")
if err != nil {
fmt.Println(err.Error())
}
defer os.RemoveAll(tmpDataDir)
// initiate a new polyjson sequence struct
var sequence polyjson.Poly
// define the meta section of our sequence.
sequence.Meta.Name = "Cat DNA"
sequence.Meta.Description = "Synthetic Cat DNA for testing purposes."
sequence.Meta.CreatedBy = "Catz (all you basepair are belong to us)"
sequence.Meta.CreatedOn = time.Now()
sequence.Meta.URL = "www.allyourbasepair.com/catz"
sequence.Meta.CreatedWith = "Poly - The world's most modern, open source software library for engineering organisms."
// add our sequence string and its hash to use as a unique identifier.
sequence.Sequence = "CATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCAT"
sequence.Meta.Hash, _ = seqhash.Hash(sequence.Sequence, "DNA", false, true)
// add our sequence features
catFeature := polyjson.Feature{}
catFeature.Name = "Cat coding region."
catFeature.Description = "a cat coding region at the beginning of our sequence."
catFeature.Type = "CDS"
catFeature.Location.Start = 0
catFeature.Location.End = 8
catFeature.Tags = map[string]string{"product": "cat protein"}
_ = sequence.AddFeature(&catFeature) // add the feature annotation to our sequence
// write our sequence to a JSON file
tmpJSONFilePath := filepath.Join(tmpDataDir, "sample.json")
_ = polyjson.Write(sequence, tmpJSONFilePath)
exportedSequence, _ := polyjson.Read(tmpJSONFilePath)
// print our struct DNA sequence
fmt.Println(exportedSequence.Sequence)
}
Output: CATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCAT
Index ¶
Examples ¶
Constants ¶
This section is empty.
Variables ¶
This section is empty.
Functions ¶
func Write ¶
Write writes a Poly struct out to json.
Example ¶
package main
import (
"fmt"
"os"
"path/filepath"
"github.com/TimothyStiles/poly/io/polyjson"
)
func main() {
tmpDataDir, err := os.MkdirTemp("", "data-*")
if err != nil {
fmt.Println(err.Error())
}
defer os.RemoveAll(tmpDataDir)
sequence, _ := polyjson.Read("../../data/cat.json")
tmpJSONFilePath := filepath.Join(tmpDataDir, "sample.json")
_ = polyjson.Write(sequence, tmpJSONFilePath)
testSequence, _ := polyjson.Read(tmpJSONFilePath)
fmt.Println(testSequence.Sequence)
}
Output: CATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCAT
Types ¶
type Feature ¶ added in v0.19.0
type Feature struct {
Name string `json:"name"`
Hash string `json:"hash"`
Type string `json:"type"`
Description string `json:"description"`
Location Location `json:"location"`
Tags map[string]string `json:"tags"`
Sequence string `json:"sequence"`
ParentSequence *Poly `json:"-"`
}
Feature contains all the feature data for a poly feature struct.
func (Feature) GetSequence ¶ added in v0.19.0
GetSequence takes a feature and returns a sequence string for that feature.
Example ¶
package main
import (
"fmt"
"github.com/TimothyStiles/poly/io/polyjson"
)
func main() {
// Sequence for greenflourescent protein (GFP) that we're using as test data for this example.
gfpSequence := "ATGGCTAGCAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGGCACAAATTTTCTGTCAGTGGAGAGGGTGAAGGTGATGCTACATACGGAAAGCTTACCCTTAAATTTATTTGCACTACTGGAAAACTACCTGTTCCATGGCCAACACTTGTCACTACTTTCTCTTATGGTGTTCAATGCTTTTCCCGTTATCCGGATCATATGAAACGGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAACGCACTATATCTTTCAAAGATGACGGGAACTACAAGACGCGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTAATCGTATCGAGTTAAAAGGTATTGATTTTAAAGAAGATGGAAACATTCTCGGACACAAACTCGAGTACAACTATAACTCACACAATGTATACATCACGGCAGACAAACAAAAGAATGGAATCAAAGCTAACTTCAAAATTCGCCACAACATTGAAGATGGATCCGTTCAACTAGCAGACCATTATCAACAAAATACTCCAATTGGCGATGGCCCTGTCCTTTTACCAGACAACCATTACCTGTCGACACAATCTGCCCTTTCGAAAGATCCCAACGAAAAGCGTGACCACATGGTCCTTCTTGAGTTTGTAACTGCTGCTGGGATTACACATGGCATGGATGAGCTCTACAAATAA"
// initialize sequence and feature structs.
var sequence polyjson.Poly
var feature polyjson.Feature
// set the initialized sequence struct's sequence.
sequence.Sequence = gfpSequence
// Set the initialized feature name and sequence location.
feature.Description = "Green Fluorescent Protein"
feature.Location.Start = 0
feature.Location.End = len(sequence.Sequence)
// Add the GFP feature to the sequence struct.
_ = sequence.AddFeature(&feature)
// get the GFP feature sequence string from the sequence struct.
featureSequence, _ := feature.GetSequence()
// check to see if the feature was inserted properly into the sequence.
fmt.Println(gfpSequence == featureSequence)
}
Output: true
type Location ¶ added in v0.19.0
type Location struct {
Start int `json:"start"`
End int `json:"end"`
Complement bool `json:"complement"`
Join bool `json:"join"`
FivePrimePartial bool `json:"five_prime_partial"`
ThreePrimePartial bool `json:"three_prime_partial"`
SubLocations []Location `json:"sub_locations"`
}
Location contains all the location data for a poly feature's location.
type Meta ¶ added in v0.19.0
type Meta struct {
Name string `json:"name"`
Hash string `json:"hash"`
Description string `json:"description"`
URL string `json:"url"`
CreatedBy string `json:"created_by"`
CreatedWith string `json:"created_with"`
CreatedOn time.Time `json:"created_on"`
Schema string `json:"schema"`
}
Meta contains all the metadata for a poly sequence struct.
type Poly ¶ added in v0.19.0
type Poly struct {
Meta Meta `json:"meta"`
Features []Feature `json:"features"`
Sequence string `json:"sequence"`
}
Poly is poly's native JSON representation of a sequence.
func Parse ¶
Parse parses a Poly JSON file and adds appropriate pointers to struct.
Example ¶
package main
import (
"fmt"
"os"
"github.com/TimothyStiles/poly/io/polyjson"
)
func main() {
file, _ := os.Open("../../data/cat.json")
sequence, _ := polyjson.Parse(file)
fmt.Println(sequence.Sequence)
}
Output: CATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCAT
func Read ¶
Read reads a Poly JSON file.
Example ¶
package main
import (
"fmt"
"github.com/TimothyStiles/poly/io/polyjson"
)
func main() {
sequence, _ := polyjson.Read("../../data/cat.json")
fmt.Println(sequence.Sequence)
}
Output: CATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCAT
func (*Poly) AddFeature ¶ added in v0.19.0
AddFeature adds a feature to a Poly struct. Does not add the feature's sequence
Example ¶
package main
import (
"fmt"
"github.com/TimothyStiles/poly/io/polyjson"
)
func main() {
// Sequence for greenflourescent protein (GFP) that we're using as test data for this example.
gfpSequence := "ATGGCTAGCAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGGCACAAATTTTCTGTCAGTGGAGAGGGTGAAGGTGATGCTACATACGGAAAGCTTACCCTTAAATTTATTTGCACTACTGGAAAACTACCTGTTCCATGGCCAACACTTGTCACTACTTTCTCTTATGGTGTTCAATGCTTTTCCCGTTATCCGGATCATATGAAACGGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAACGCACTATATCTTTCAAAGATGACGGGAACTACAAGACGCGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTAATCGTATCGAGTTAAAAGGTATTGATTTTAAAGAAGATGGAAACATTCTCGGACACAAACTCGAGTACAACTATAACTCACACAATGTATACATCACGGCAGACAAACAAAAGAATGGAATCAAAGCTAACTTCAAAATTCGCCACAACATTGAAGATGGATCCGTTCAACTAGCAGACCATTATCAACAAAATACTCCAATTGGCGATGGCCCTGTCCTTTTACCAGACAACCATTACCTGTCGACACAATCTGCCCTTTCGAAAGATCCCAACGAAAAGCGTGACCACATGGTCCTTCTTGAGTTTGTAACTGCTGCTGGGATTACACATGGCATGGATGAGCTCTACAAATAA"
// initialize sequence and feature structs.
var sequence polyjson.Poly
var feature polyjson.Feature
// set the initialized sequence struct's sequence.
sequence.Sequence = gfpSequence
// Set the initialized feature name and sequence location.
feature.Description = "Green Fluorescent Protein"
feature.Location = polyjson.Location{}
feature.Location.Start = 0
feature.Location.End = len(sequence.Sequence)
// Add the GFP feature to the sequence struct.
_ = sequence.AddFeature(&feature)
// get the GFP feature sequence string from the sequence struct.
featureSequence, _ := feature.GetSequence()
// check to see if the feature was inserted properly into the sequence.
fmt.Println(gfpSequence == featureSequence)
}
Output: true